Back in September 2020 Kathleen Marden (abduction researcher and niece of Betty Hill) advised me that chemist Phyllis Budinger had recently raised questions regarding DNA found on the right sleeve of Betty Hill's dress. The dress in question had been worn by Betty Hill in her claimed alien abduction in 1961, most prominently documented in the 1966 best selling book “The Interrupted Journey – Two Lost Hours “Aboard a Flying Saucer”” written by John G. Fuller. Kathleen Marden and Stanton Friedman had also written “Captured! The Betty and Barney Hill Story” published in 2007.
The Peter Khoury “Hair of the Alien” case is an excellent case study in applying forensic DNA techniques to biological evidence implicated in an apparent alien abduction experience that took place in Sydney Australia in 1992. While its nature is controversial, the investigation and research carried out by the Anomaly Physical Evidence Group (APEG) highlighted a range of DNA anomalies, that were not easy to reconcile with prosaic realities. We attempted to create a focus on applying forensic DNA techniques to claims of alien abduction, but very few cases have had this kind of follow-up. The Khoury case is a compelling example of an alien abduction claim that was supported by DNA evidence, rather than being undermined by it. The evidence does not prove an alien reality, but it certainly makes a sound contribution to the possibility. Many more cases of merit are required to gain more confidence in the possibility of alien reality in abduction claims. The Khoury case investigation encouraged my research into what I refer to “an alien DNA paradigm”, namely on evidence for alien genetic “intelligent intervention” in various cultures (particularly indigenous cultures) around the world, and has been driven by:
• Locations with high strangeness/breakthrough activities with UFOs, light phenomena, alien abductions
• cultures that feature “sky being” claims, diverse UFO phenomena
• possible unusual DNA markers within these cultures or present selectively or generically in human DNA
• locations or regions which bring together each of these factors (UFO “haunted” location, alien mediated culture, DNA aspects).
Initially I responded to Kathleen Marden's enquiry somewhat tentatively and cautiously while trying to get to the bottom of the issues involved. I wrote, “This is intriguing. I would need to get back into the Golden Triangle ethnic minorities DNA sequencing data again and whether back in the 1960s the separation of the various people was more obvious. Hmong, Mien, Lisu, Akha, Karen & Lahu. Obviously detailed DNA sequencing of the various ethnic groups is a more recent thing, the last few decades, but it was the Lahu we focused on, because of some of DNA results (that my group found in the Khoury hair sample). That took me to northern Thailand and Southern Yunnan province, where I meet with Lahu people. I would have to consult with my references here to see how DNA diverse Hmong, Mien & Lahu are, but I suspect intermingling, but it wasn't so long ago, during the mid 20th century that the Lahu were often feared because of their territoriality and bow & arrow marksmanship. I would certainly like to find out more on this from Phyllis. It may be that these group are not all that diverse genetically, but I would have to check this out further. Plus, I will have a chat with Dr. Horace Drew, who first brought up the Lahu connection with us. The Hmong as a group had an unfortunate propensity for sleep paralysis and in some cases death. There is a fascinating body of "sky lore" etc within the Lahu.”
Attempts to clarify the matter were confused by what was described as a “bombshell” discussion on a New Frontier Network panel discussion recorded August 27, 2020. Panel member, abduction researcher Kathleen Marden, indicated that DNA on her aunt Betty Hill's dress matched the DNA from the Australian Hair of the Alien case. Kathleen indicated, "Her dress underwent DNA analysis and Phyllis Budinger who was the analytical chemist who began the work on her case and then sent the dress out for DNA analysis for samples, discovered that there's Chinese DNA on her dress. And that Chinese DNA is the same DNA that was found in Hair of the Alien". Upon hearing this, fellow panellist Richard Dolan stated "Kathleen has just mentioned, which I didn't know, the fact that a DNA analysis of Betty Hill's dress had genetic traces of a particular Chinese genetics.
“That's fascinating because there was a hair that was left behind in this encounter that wasn't just Chinese - it was a very very ultra rare - a subgroup you could say if I understand correctly a group that is basically living almost an aboriginal forest type existence very remote. Whereas all of those individuals had black hair but this particular hair which was unbleached they determined was blonde. It's very bizarre, very very bizarre. It's a strand in that case - very intriguing. But I didn't know that the connection with Betty Hill's dress - so that is absolutely fascinating to me. I don't know how I missed it, that's unbelievable."
Kathleen Marden indicated it was a "recent development" and "It was the same sub group and that's why she has come forward and stated this."
Richard Dolan responded, "That really needs some serious blowing out and follow up - it's absolutely fascinating."
It wasn’t clear to me then, whether these developments originated from earlier or more recent DNA work and it took some time to clarify what was involved. As it turned out the claim in question was not based on new DNA studies, but rather on data supplied by me way back in 2004 and 2005 to Phyllis Budinger. The connection to the Asian DNA sequences reported in the Khoury sample work had not been established with sufficient certainty. Further work is required.
In my manuscript for my book “Hair of the Alien” which was published in 2005:
“The opportunity to examine important alien abduction cases in a forensic way represents a potential path towards accessing the kind of evidence that might anchor the search for evidence in some sort of solid reality. If the case has biological evidence then clues of a genetic nature may possibly emerge, rooted in our rapidly burgeoning DNA knowledge. Latein 2003 fellow chemist Phyllis Budinger circulated her striking analysis of the dress Betty Hill wore during her famous abduction of 1961. The dress, which has a large pink stain on the front, had been hanging in the closet of Betty’s New Hampshire home relatively undisturbed all these many years. Budinger investigated the 40-year-old dress looking for evidence to back up the claimed alien encounter. Shefelt that the stain and possible residues might be related to Betty’s handling by the alien beings she described during her encounter. Bundinger’s analyses yielded results suggestive of protein type material leading her to suggest this might make DNA analysis worthwhile. While it was a very long shot, the nature and importance of the Betty and Barney Hill case suggested it could be worthwhile. (Reference: “Betty Hill Dress Analysis” – Technical Service ResponseNo. UT025, October 19 2003, and personal communications)
“My APEG team received some dress samples and control biological samples pertinent to Betty and Barney Hill. A specialized (ribosomal) PCR DNA profiling was undertaken to extract non-human DNA along with standard assessments. While the results confirmed nothing of an explicit alien nature they turned up striking evidence for the usefulness of the techniques. Despite the passage of decades DNA evidence of the linkage with Betty and Barney was confirmed, and rather surprisingly at least some of the stained areas were found to be due to spider’s blood. At best these and other DNA results may have therefore supported Betty being in a wooded setting, but ultimately it all powerfully argues for the importance of applying these techniques quickly and comprehensively and not losing the opportunities of elaborating on the nature of credible cases. Had such approaches been available back in the sixties, rooted in a comprehensive forensic investigation, we can only wonder what breakthroughs may have emerged. But for now the emerging forensic DNA approach resonates with the legacy of Betty Hill’s extraordinary experience. Sadly, while she became aware of the work as it progressed she passed away before it was finalized.”
I thought the possible Lahu/Hmong linkages that may exist in the two cases warranted further elaboration. Dr. Horace Drew, who coordinated the "Hair of the Alien" DNA work, was skeptical of a connection. He reminded me that we did all-species PCR on the stain which clearly showed New Hampshire spider’s blood. He indicated if you do human-specific PCR, you can get, at a less concentrated level, DNA from anyone who may have touched the dress. He wondered, perhaps not too seriously, whether the dress that been dry cleaned and handled by possible Hmong people. I told him I was actually thinking the same thing, so querying the blast results, and determining when did Hmong first come to the US - November 1975 it seems - so how did, assuming the results are reliable, Hmong DNA get onto Betty Hills dress? The detection came from the right sleeve, not the spider stained area." The matter of a possible Hmong related marker is curious, but I guess a reasonable question would be, was the dress ever put on display between November 1975 and 2004? Was it handled directly by others? Hmong dry cleaning?? Hmong UFO fans? I have Anne Fadiman’s 1997 book “The Spirit catches you and you fall down - A Hmong child, her American doctors, and the collision of two cultures”, which may feed into this issue - a valid or spurious anomaly?
At the time of the dress DNA analysis (2004-2005), we felt the primary data of importance was the spider blood finding. Secondary data, such as trace findings of Hmong Asian DNA, that may have been indicative of someone of Hmong origin or connection touching the dress was not really significant. We were only in the early stages of developing the analysis data on the Lahu findings in the Khoury case and determining the importance of a Lahu focused field investigation in Thailand and South West China. As that became very significant, attention focused on Lahu data in the Khoury case, not a trace finding in the separate study of the Betty Hill dress.
With Kathleen Marden and PhyIiss Budinger now drawing attention to the Hmong finding on Betty Hill’s dress, I felt further discussion, debate and thoughtful consideration would be needed, rather than knee-jerk debunking dismissal. The difficulty as I now saw it, was that we needed to recheck the original analysis data (work carried out by an excellent DNA analyst, supervised by Dr. Horace Drew, with the data supplied to me, then brought to together, reviewed with a final report forwarded to Phyliss Budinger), plus determine a detailed history of the handling of Betty Hill's dress, most specifically between 1975 to 2004, from when Hmong people started settling in the US, and Phyllis Bundinger's 2004 analysis. While it seemed doubtful, I thought it should be considered more deeply, in case a valid anomaly was lurking in the somewhat confused narratives.
Phyliss Budinger elaborated in an abbreviated version of her updated report “Examination and Analysis of Dress from Betty and Barney Hill”, published in Volume 2.1 January 25, 2021 issue of the SCU Review, the newsletter of the Scientific Coalition for UAP Studies (SCU). She wrote, “A DNA analyses was done on Left Sleeve (Swatch #1), Mid-section (Swatch #2), Right Sleeve (Swatch #3), Dress Lining stain, and finally a blood sample from Betty Hill for reference. The analyses were completed in December 2004. This was done by an expert DNA analyst with the pseudonym “Collie” who was recommended by Bill Chalker in Australia.” “Collie” was Dr. Horace Drew, but as I have already pointed out, he was supervising a competent DNA analyst, who I had contact with as well. We drew together the data amassed and finally produced a report that was accessible and understandable to Phyliss Budinger, who at that time was not well versed in DNA analysis.
Further, in the abridged report in SCU’s newsletter Phyliss Budinger wrote, “DNA Analysis is most interesting. Explainable DNA can be found on all swatches except the right and left sleeves. For example, analysis revealed the stain on the back lining of the skirt is spider blood. Betty apparently sat on a spider during the journey. Kathleen Marden told me that Betty had a hot dog in Canada and sat at a picnic table to eat it. Also there was human, mouse, and cow DNA. But there are two DNA results that raise questions. These are DNA sequences from soil bacteria and the Hmong-Mien speaking population from East Asia.”
“Also on the right sleeve is the Hmong-Mien DNA sequence. This demands explanation. Kathleen Marden related to me that Betty did not know anyone of Asian extract, nor is there any indication that the dress was ever handled by an Asian or made in Asia. In fact, Kathleen Marden suspects the dress was handmade by her grandmother, mother, or Betty. They often made clothing for themselves and others in the family. Furthermore, there is no label.
“Could the Hmong-Mien sequence have originated from the NHI (Non-Human Intelligence – Phyliss Budinger’s terminology)? Kathleen Marden related in a recent email: “Betty and Barney described the entities as having flat, Mongoloid faces and large slanted eyes.”
From the Australian DNA analyst’s 2004 report on Betty Hill’s dress, we supplied to Phyliss Budinger:
Unknown Human mitochondrial sequence (right sleeve)
Homo sapiens isolate YYM22 D-loop, partial sequence; mitochondrial
TITLE: Genetic Structure of Hmong-Mien Speaking Populations in East Asia as Revealed by mtDNA Lineages
CCACCCAAGTATTGACTCACCCACTCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATG
AATATTGTACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAACCCC
CCCCCCCC
The analyst also drew attention to results that relate to Barney Hill’s Ethiopian African ancestry:
In the mitochondrial sequence Unknown Human mitochondrial sequence (right
sleeve) there is a sequence polymorphism at position 139 (position 16188 in
the mitochondrial region). References to this sequence include the one
below, suggesting that this DNA belonged to Barney:
Bandelt, H. J., Alves-Silva, J., Guimaraes, P. E., Santos, M. S., Brehm,
A., Pereira, L., Coppa, A., Larruga, J. M., Rengo, C., Scozzari, R.,
Torroni, A., Prata, M. J., Amorim, A., Prado, V. F., Pena, S. D. (2001)
"Phylogeography of the human mitochondrial haplogroup L3e: a snapshot of
African prehistory and Atlantic slave trade " Annals of Human Genetics 65
(Pt 6): 549-563.
I sought out the full version of Phyliss Budinger’s report “Scientific Analysis of the Dress Betty Hill Wore During her CE3 Experience” where she wrote:
“Also on the right sleeve is the “Hmong-Mein” DNA sequence. This demands explanation. Kathleen Marden related to me that Betty did not know anyone of Asian extract, nor is there any indication that the dress was ever handled by an Asian or made in Asia. In fact, Kathleen Marden suspects the dress was hand made by her grandmother, mother, or Betty. They often made clothing for themselves and others in the family. Furthermore, there is no label.
“Could the Hmong-Mien sequence have originated from the NHI? Does this indicate genetic engineering done in ages past to the human race involved introducing alien DNA? Did this DNA later became known as a Hmong-Mien sequence? Kathleen Marden related in a recent email: “Betty and Barney described the entities as having flat Mongoloid faces and large slanted eyes.”
“There is precedence for the above questions. Bill Chalker’s book “Hair of the Alien” reports the assault of Peter Khoury by a Nordic-appearing female NHI. The DNA results of a blond hair she left behind shows the shaft is of a rare Chinese Mongoloid type. (Chapter 5) Yet the NHI’s hair was blond and not black. Furthermore, the root of the hair is a rare Basque/Gaelic type. To me, this is a clear indication of genetic engineering.
“In support, I present an artist’s depiction, as well as a sculpted head Betty would show at meetings and conferences. They were crafted from her description of the NHI’s appearance.
“Following are photographs of people of Hmong-Mien extraction. There appears to be a resemblance. 
“A racial similarity – A genetic connection?
“Recommendation
“More DNA testing has to be done on the right sleeve, and perhaps the torn zipper area which the NHIs had trouble undoing. The “Scientific Method” dictates this must be done. The 2004 results need confirmation. This should be done by a highly qualified scientist well-versed in the most modern DNA procedures. There was DNA on the right sleeve in 2004. I feel some remains in 2020.”
Clearly more than facial similarities is needed. Given that the Khoury DNA data was gathered mainly in the period 1999 to 2004 (from a hair sample located by Peter Khoury in Sydney during 1992), and the Betty Hill dress DNA data was gathered in 2004/2005 (from the dress worn by Betty in 1961, which was mainly located in New Hampshire), as Phyliss Budinger suggests, the possible linkage of the two cases through the trace Hmong data would be useful to examine further via more recent ethnic “hill tribe” DNA knowledge, and more modern and sensitive DNA procedures done by qualified and currently practicing DNA scientists. However, all sorts of contamination issues, ethnic Hmong/Lahu dilution/diffusion, basic facts and many other matters would have to be carefully considered in any such examination. A large complex body of increasing DNA research of ethnic hill tribes such as the Lahu and Hmong needs to be updated and reassessed, as well as any cultural data that may contribute to the idea of a possible “alien DNA paradigm”. Careful and sensible assessments should inform any activity and research in these complex phenomena.
Most of my work in this area was focused on the Lahu, as the Khoury hair DNA sequence data directed us to them. One of my primary references on the Lahu was Anthony R. Walker’s classic study “Merit and the Millenium – Routine and Crisis in the Ritual lives of the Lahu People” (2003). In one of his study areas (close to the Lahu village I visited north of Chiang Mai, in northern Thailand in 2006) highlighted that there were Hmong and Lahu settlements in close proximity. Opportunities for Hmong/Lahu diffusion/dilution may have existed. Since Hmong refugees (plus far fewer Lahu), who had participated in the secret guerrilla wars in Asia, migrated to the US from 1975 to about 1999, mainly settled in California, with limited resettlements in places like Colorado, the lack of settlement in states like New Hamsphire, suggests limited prosaic opportunities of touching Betty Hill’s dress that was mainly located there. The dress went on display at the University of New Hampshire Library in 2016 and still remains in the university’s Betty and Barney Hill archive collection.
The kind of handling of the dress I observed in the recent Alien Abduction Shock Doc on the Hill case might make for good viewing but despite the use of gloves, other precautions to avoid potential DNA contamination (masks etc) didn’t seem much in evidence. Rapidly evolving DNA techniques may improve their utility, but sensitivity and contamination issues increase. These are issues that need to be taken on board with any new DNA focused analyses.
Prosaic spider blood identification, possible Hmong/Lahu connections, African ancestry confirmations: the potential power of DNA analysis in assisting in the resolution of anomaly issues in “alien abduction” and UAP/UFO issues, where appropriate, should be self evident.
Finally, here are some of the reasons why the Lahu/Hmong connections might be worthwhile pursuing. These are Lahu focused because they developed from the Khoury sample enquiry.
My trips to Thailand and China during 2005 and 2006 exploring the Asian UFO experience and evidence for an “alien DNA paradigm”, also yielded evidence possibly supportive of the shamanic alien abduction connection. I was focusing on genetic connections at a very specific and detailed level, because of the unusual nature of the rare Asian mongoloid sequence, revealed in the Khoury sample, and described in my book “Hair of the Alien”. They occurred in the DNA signatures of an isolated group of people – the Lahu who were limited to the region of the southern Chinese province of Yunnan, and the immediate regions bordering that locality – northern Thailand, Myanmar (Burma), and Laos. The areas of Yunnan and northern Thailand yielded considerable data and research, particularly with fascinating UFO and unusual light phenomena connections in both regions.
Strange light phenomena and possible UFO connections are found in the shamanic type elements of Lahu society. Dr. Anthony Walker’s 907 page Lahu study “Merit and the Millenium – Routine and Crisis in the Ritual Lives of the Lahu People”, revealsone of the more fascinating Lahu shaman-like contact experiences involving a leading Lahu figure Ca Nu who claimed the Sky beings/spirits visited him and gave him a mysterious glowing stone with inscriptions. He also reported seeing strange “hole” shapes crossing the sun (sunspots?), along with possibly anomalous “stars”. Ca Nu connects his experiences with spiritual prophecy, a dynamic revealed on numerous occasions in not only shaman lore but in many claimed alien contact and abduction situations.
Yang Zheng of the Kunming UFO Research Association indicated his “most dramatic case” occurred in November 2006 (the month after my visit to Yunnan) when thousands of villagers in Zhenyuan Yi, Hani and Lahu Autonomous County of Yunnan Province witnessed 7 white hemispherical shaped objects hovering directly above the property of a local CPC (Chinese Communist Party) cadre for nearly two hours. The objects appeared to keep changing shape. As it was a small village word soon spread and many villagers arrived to witness the sighting. They started pursuing the objects but the UFOs soon disappeared. I had been in the Lahu territory, only a few weeks earlier.
All this seems a compelling confirmation of the potential breakthrough research focus provide by the alien DNA paradigm and a shamanic alien abduction perspective and for pursuing possible Lahu/Hmong connections in this exotic area.
For those who wish to explore the shamanic alien abduction connection further, check out my 2 part article in New Dawn magazine (September-October 2021 & November-December 2021). Back issues can be obtain via the New Dawn web site.
I found this site specialized in Alien products:
ReplyDeletehttps://alien-shopping.com
Do you think it's legit ?